labeled primer Search Results


93
TaKaRa random primer labeling kit
Random Primer Labeling Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/random primer labeling kit/product/TaKaRa
Average 93 stars, based on 1 article reviews
random primer labeling kit - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
Promega labeled primer
Labeled Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/labeled primer/product/Promega
Average 90 stars, based on 1 article reviews
labeled primer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
DuPont de Nemours renaissance random primer fluorescein–dutp labelling kit
Renaissance Random Primer Fluorescein–Dutp Labelling Kit, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/renaissance random primer fluorescein–dutp labelling kit/product/DuPont de Nemours
Average 90 stars, based on 1 article reviews
renaissance random primer fluorescein–dutp labelling kit - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
NEN Life Science random primer plus extension labeling system
Random Primer Plus Extension Labeling System, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/random primer plus extension labeling system/product/NEN Life Science
Average 90 stars, based on 1 article reviews
random primer plus extension labeling system - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GeneWorks fluorescent-labeled primers
Fluorescent Labeled Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescent-labeled primers/product/GeneWorks
Average 90 stars, based on 1 article reviews
fluorescent-labeled primers - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Microsynth ag fluorescently labelled primers 534r_green
Fluorescently Labelled Primers 534r Green, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescently labelled primers 534r_green/product/Microsynth ag
Average 90 stars, based on 1 article reviews
fluorescently labelled primers 534r_green - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Eurofins primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg
Primers Produce Biotin Labeled Widom 601 F: Biotin Ccggctcgtatgttgtgtg R: Gagtcgctgttcaatacatg, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg/product/Eurofins
Average 90 stars, based on 1 article reviews
primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Eurofins 5′ fam-labeled reverse transcription primer
5′ Fam Labeled Reverse Transcription Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5′ fam-labeled reverse transcription primer/product/Eurofins
Average 90 stars, based on 1 article reviews
5′ fam-labeled reverse transcription primer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GeneWorks labeled forward primers fam
Labeled Forward Primers Fam, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/labeled forward primers fam/product/GeneWorks
Average 90 stars, based on 1 article reviews
labeled forward primers fam - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Metabion International AG primers and a fam-labeled probe
Primers And A Fam Labeled Probe, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers and a fam-labeled probe/product/Metabion International AG
Average 90 stars, based on 1 article reviews
primers and a fam-labeled probe - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Amersham Life Sciences Inc 32p end-labelled consensus jh21 primer
32p End Labelled Consensus Jh21 Primer, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/32p end-labelled consensus jh21 primer/product/Amersham Life Sciences Inc
Average 90 stars, based on 1 article reviews
32p end-labelled consensus jh21 primer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Kaneka Corp sense primers labeled 5′ position cy-5 fluorescent dye
Sense Primers Labeled 5′ Position Cy 5 Fluorescent Dye, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sense primers labeled 5′ position cy-5 fluorescent dye/product/Kaneka Corp
Average 90 stars, based on 1 article reviews
sense primers labeled 5′ position cy-5 fluorescent dye - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results