93
|
TaKaRa
random primer labeling kit Random Primer Labeling Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/random primer labeling kit/product/TaKaRa Average 93 stars, based on 1 article reviews
random primer labeling kit - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
90
|
Promega
labeled primer Labeled Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/labeled primer/product/Promega Average 90 stars, based on 1 article reviews
labeled primer - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
DuPont de Nemours
renaissance random primer fluorescein–dutp labelling kit Renaissance Random Primer Fluorescein–Dutp Labelling Kit, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/renaissance random primer fluorescein–dutp labelling kit/product/DuPont de Nemours Average 90 stars, based on 1 article reviews
renaissance random primer fluorescein–dutp labelling kit - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
NEN Life Science
random primer plus extension labeling system Random Primer Plus Extension Labeling System, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/random primer plus extension labeling system/product/NEN Life Science Average 90 stars, based on 1 article reviews
random primer plus extension labeling system - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
fluorescent-labeled primers Fluorescent Labeled Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fluorescent-labeled primers/product/GeneWorks Average 90 stars, based on 1 article reviews
fluorescent-labeled primers - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
fluorescently labelled primers 534r_green Fluorescently Labelled Primers 534r Green, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fluorescently labelled primers 534r_green/product/Microsynth ag Average 90 stars, based on 1 article reviews
fluorescently labelled primers 534r_green - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg Primers Produce Biotin Labeled Widom 601 F: Biotin Ccggctcgtatgttgtgtg R: Gagtcgctgttcaatacatg, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg/product/Eurofins Average 90 stars, based on 1 article reviews
primers produce biotin-labeled widom 601 f: biotin-ccggctcgtatgttgtgtg r: gagtcgctgttcaatacatg - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
5′ fam-labeled reverse transcription primer 5′ Fam Labeled Reverse Transcription Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5′ fam-labeled reverse transcription primer/product/Eurofins Average 90 stars, based on 1 article reviews
5′ fam-labeled reverse transcription primer - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
labeled forward primers fam Labeled Forward Primers Fam, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/labeled forward primers fam/product/GeneWorks Average 90 stars, based on 1 article reviews
labeled forward primers fam - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
primers and a fam-labeled probe Primers And A Fam Labeled Probe, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers and a fam-labeled probe/product/Metabion International AG Average 90 stars, based on 1 article reviews
primers and a fam-labeled probe - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Amersham Life Sciences Inc
32p end-labelled consensus jh21 primer 32p End Labelled Consensus Jh21 Primer, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/32p end-labelled consensus jh21 primer/product/Amersham Life Sciences Inc Average 90 stars, based on 1 article reviews
32p end-labelled consensus jh21 primer - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Kaneka Corp
sense primers labeled 5′ position cy-5 fluorescent dye Sense Primers Labeled 5′ Position Cy 5 Fluorescent Dye, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sense primers labeled 5′ position cy-5 fluorescent dye/product/Kaneka Corp Average 90 stars, based on 1 article reviews
sense primers labeled 5′ position cy-5 fluorescent dye - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |